Polymorphisms for ABC05836

Schematic of mutation locations within contig assembly 'ABC05836_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 1
3
3
1
5
2
1
6
0
1
7
7
2
2
1
2
4
8
2
4
9
3
8
4
4
0
7
4
1
5
4
1
6
4
5
5
4
6
0
4
8
4
5
1
9
5
2
1
5
3
2
5
4
8
5
6
1
5
8
9
1
0
3
6
1
0
5
4
1
1
1
0
1
1
1
4
1
1
3
7
1
1
9
8
1
2
2
6
1
3
3
8
1
4
0
7
1
4
0
9
Golden Promise |L01R01| R|a_1....................AGTACCATGT
Golden Promise |L01R01| L|a_1CTGACGTCCCCAATACTGGT
HS92 |L01R01| L|a_1CTGATGTCCCCAATACTGGC
HS92 |L01R01| R|a_1....................AGTACTATGT
Lina |L01R01| L|a_1CTGACGTCCCCAATACTGGT
Lina |L01R01| R|a_1....................AGTACCATGT
Morex |L01R01| R|a_1....................AGTACCATGT
Morex |L01R01| L|a_1CTGACGTCCCCAATACTGGT
OWB D |L01R01| R|a_1....................AACCGCGCAA
OWB D |L01R01| L|a_1TCCGCACTTTTGGCGCCAGC
Optic |L01R01| R|a_1....................AGTACCATGT
Optic |L01R01| L|a_1CTGACGTCCCCAATACTGGT
OWB R |L01R01| L|a_1CTGACGTCCCCAATACTGGC
OWB R |L01R01| R|a_1....................AGTACCATGT
Steptoe |L01R01| R|a_1....................AGTACTATGT
Steptoe |L01R01| L|a_1CTGATGTCCCCAATAATGAC