Polymorphisms for ABC06381

Schematic of mutation locations within contig assembly 'ABC06381_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 1
8
4
2
3
5
3
3
7
3
4
7
3
5
8
3
6
8
3
6
9
3
7
9
4
7
8
4
9
0
5
1
0
5
1
4
5
9
7
6
9
9
7
2
6
7
2
8
7
4
2
7
4
3
7
5
2
7
5
7
7
5
9
7
6
2
7
6
9
Golden Promise |L01R01| R|a_1GGCGTCACTTTGCGTACAAGATA
Golden Promise |L01R01| L|a_1GGCGTCACTTTGCGTACAAGATA
HS92 |L01R01| L|a_1GCCGTCACTTTGCGTACAAGACA
HS92 |L01R01| R|a_1GCCGTCACTTTGCGTACAAGACA
Lina |L01R01| R|a_1TCTGGGGTCCCACAGCAGGGTCG
Lina |L01R01| L|a_1TCTGGGGTCCCACAGCAGGGTCG
Morex |L01R01| R|a_1GGCGTCACTTTGCGTACAAGATA
Morex |L01R01| L|a_1CATAGACAAAGAGCTTGCTAACC
OWB D |L01R01| R|a_1GGTTTGGTTTTGCGTACAAGATA
OWB D |L01R01| L|a_1GGTTTGGTTTTGCGTACAAGATA
Optic |L01R01| R|a_1GGCGTCACTTTGCGTACAAGATA
Optic |L01R01| L|a_1GGCGTCACTTTGCGTACAAGATA
OWB R |L01R01| L|a_1TCTGGGGTCCCACAGCAGGGTCG
OWB R |L01R01| R|a_1TCTGGGGTCCCACAGCAGGGTCG
Steptoe |L01R01| R|a_1GGTGTCACTTTGGAGCGCGCTCG
Steptoe |L01R01| L|a_1GGTGTCACTTTGGAGCGCGCTCG