Polymorphisms for ABC07501

Schematic of mutation locations within contig assembly 'ABC07501_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 9
1
1
6
8
1
8
4
2
6
5
2
6
8
2
7
6
3
1
6
3
2
5
3
2
7
3
3
2
3
3
4
3
3
9
3
4
1
3
5
6
3
5
9
3
7
2
4
1
5
4
1
8
4
4
5
4
6
3
4
6
6
4
8
4
5
3
6
5
5
3
5
8
3
5
9
3
6
0
2
6
1
5
6
1
9
6
2
7
6
3
4
6
3
5
Golden Promise |L01R01| R|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
Golden Promise |L01R01| L|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
HS92 |L01R01| L|a_1CACCGCCTATACTCGTCTTCGATCCCCA*ATG
HS92 |L01R01| R|a_1CACCGCCTATACTCGTCTTCGATCCCCA*ATG
Lina |L01R01| R|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
Lina |L01R01| L|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
Morex |L01R01| L|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
Morex |L01R01| R|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
OWB D |L01R01| L|a_1TGCCACCGATACTCGTCTTCTATTCCCAGATG
OWB D |L01R01| R|a_1TGCCACCGATACTCGTCTTCTATTCCCAGATG
Optic |L01R01| L|a_1CACCGCCTATACGCGTCTTCGATCCCCA*ATG
Optic |L01R01| R|a_1CACCGCCTATACGCGTCTTCGATCCCCA*ATG
OWB R |L01R01| R|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
OWB R |L01R01| L|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
Steptoe |L01R01| R|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
Steptoe |L01R01| L|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA