Polymorphisms for ABC07565

Schematic of mutation locations within contig assembly 'ABC07565_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 2
3
3
2
5
4
6
3
1
0
1
1
3
8
1
4
4
2
2
2
2
8
2
2
8
7
3
0
3
3
1
2
3
2
1
3
3
3
3
4
2
3
6
6
3
6
7
3
6
9
3
7
2
3
8
2
3
8
4
3
9
0
4
0
2
4
1
0
4
1
1
4
1
7
4
2
0
4
2
9
4
3
2
4
4
8
4
5
8
4
5
9
4
6
9
4
7
1
Golden Promise |L01R01| L|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
HS92 |L01R01| L|a_1GTGCTACGCAGTCTTGCCGTGGCGAAGGCACtGT
HS92 |L01R01| R|a_1GTGCTACGCAGTCTTGCCGTGGCGAAGGCACTGT
Lina |L01R01| R|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
Lina |L01R01| L|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
Morex |L01R01| R|a_1a*aGGGGCTGACTCCATGCGAAGCGGACAGGGTG
OWB D |L01R01| R|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
OWB D |L01R01| L|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
Optic |L01R01| R|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
OWB R |L01R01| R|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
OWB R |L01R01| L|a_1GAAgGGGCtGAcTgCAtgCgAAGggGaCAGggtG
Steptoe |L01R01| R|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG
Steptoe |L01R01| L|a_1TAAGGGGCTGACTCCATGCGAAGCGGACAGGGTG