Polymorphisms for ABC17320

Schematic of mutation locations within contig assembly 'ABC17320_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 5
0
5
9
6
1
7
1
8
2
8
3
1
1
1
1
1
9
1
3
2
1
4
5
1
4
6
1
7
5
1
7
6
3
1
2
4
5
3
4
6
5
4
6
8
4
8
0
4
8
3
5
1
4
Golden Promise |L01R01| L|a_1AGTGAAGCGCATTGCGGGTT
Golden Promise |L01R01| R|a_1AGTGAAGCGCATTGCGGGTT
HS92 |L01R01| L|a_1AGCCAAAAGCATTTTGGGTC
HS92 |L01R01| R|a_1AGCCAAAAGCATTTTGGGTC
Lina |L01R01| R|a_1AGTGAAGCGCATTGCGGGTT
Lina |L01R01| L|a_1AGTGAAgCGCATTGCGGGTT
Morex |L01R01| L|a_1ACCGTTGCCATT*GCAATCT
Morex |L01R01| R|a_1TttTATAGGGAATAC*gGCT
OWB D |L01R01| L|a_1AGCGAAGCCCTT*GCAATCT
OWB D |L01R01| R|a_1CTACTTATAGAATGAAATAG
Optic |L01R01| R|a_1ATAACGTAGGTCACCGCTGC
Optic |L01R01| L|a_1AGCGTAGCCATT*GCGGGTT
OWB R |L01R01| L|a_1GGCGTAGCGCATTGCGGGTT
OWB R |L01R01| R|a_1GGCGTAGCGCATTGCGGGTt
Steptoe |L01R01| R|a_1AGtGAAGCGCATTGCGGGTg
Steptoe |L01R01| L|a_1AGTGAAGCGCATTGCGGGTT