Polymorphisms for ABC21640

Schematic of mutation locations within contig assembly 'ABC21640_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 4
7
7
0
7
1
7
4
9
5
1
0
4
1
1
5
1
1
6
1
3
6
1
3
8
1
4
2
1
5
6
1
6
5
1
8
3
1
9
2
2
3
7
2
4
0
2
4
6
2
6
6
3
2
8
Golden Promise |L01R01| R|a_1CGTTTGTGTGATACGGGGAC
Golden Promise |L01R01| L|a_1*GTTTGTGTGATACGGGGAC
Lina |L01R01| L|a_1TAGGTATCTGGCACGGGGAT
Lina |L01R01| R|a_1TAGGTATCTGGCACGGGGAT
Morex |L01R01| L|a_1CATTTAAGTAGCACGGGGAC
OWB D |L01R01| R|a_1CGTTCATGCGGCgTGGGGAT
OWB D |L01R01| L|a_1cGTTCATGCGGCGTGGGGAT
Optic |L01R01| L|a_1cATTTATGCGGCGCGGGGAT
Optic |L01R01| R|a_1CATTTATGCGGCGCGGGGAT
OWB R |L01R01| R|a_1CATTTATGCGGCgCgCaGaT
OWB R |L01R01| L|a_1cctTTATGCGGCGCGCATAT
Steptoe |L01R01| L|a_1cATTTATCCGGCGCGCAGTC