Polymorphisms for ABC46137

Schematic of mutation locations within contig assembly 'ABC46137_1'

(Hover mouse over vertical lines to highlight SNP locations in the table)



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 1
7
4
1
9
7
1
9
8
2
3
0
2
3
2
2
8
4
3
0
7
3
2
9
3
3
7
3
6
0
3
7
4
3
9
8
4
1
6
4
4
4
4
5
1
5
6
7
5
7
6
7
0
4
-
7
8
4
7
8
7
8
5
1
8
5
4
8
9
3
9
4
6
9
6
2
1
0
7
0
1
0
8
0
Golden Promise |L03R04| L|a_1gCATCTCCGctgGCtCagg
Golden Promise |L03R04| R|a_1.........cTgGCGCAGGCTGCCGCTT
Golden Promise |L04R04| R|a_1.........CGATCTCAGGGTACAGCTC
Golden Promise |L04R04| L|a_1CCGACTCCGCGATCTCAGGGTACA
HS92 |L04R04| R|a_1.........cGAGCGCAAGCCAGAGCTT
HS92 |L03R04| L|a_1ccgacTCcGCttGCtcagg
HS92 |L04R04| L|a_1CCGTCCCCTCGAGCGCAAGCCAGA
HS92 |L03R04| R|a_1.........cTgGcGcagGCTGCCGTTT
Lina |L03R04| L|a_1CCATCTCCGCTgGCGCAg
Lina |L04R04| L|a_1TAGTTCTTGCAGGTGAGGGCTGCC
Lina |L03R04| R|a_1.........CAgGCGCAGGCTGCCGCTT
Lina |L04R04| R|a_1.........cAGGTGAGGGCTGCCGCTT
Morex |L03R04| R|a_1.........CTggcGcAGGCTGCCGTTT
Morex |L03R04| L|a_1CCATCTCTGCTGGCgCAGG
Morex |L04R04| R|a_1.......ttgaacatgtgcttacAGCTC
Morex |L04R04| L|a_1CCGACTCCGCGATCTCAGGGTACA
OWB D |L04R04| R|a_1.........gTAGCGCAGTCTGCCGCCT
OWB D |L04R04| L|a_1CCGTCCCCGGTAGCGCAGTCTGCC
OWB D |L03R04| L|a_1tccACTcgtctctacctgt
OWB D |L03R04| R|a_1..........aggcgcgGGCTGCCGCTT
Optic |L03R04| L|a_1CCATCTCcGctgtctCaggc
Optic |L03R04| R|a_1.........CagGCgCAGGCTGCCGCTT
Optic |L04R04| R|a_1.........CGATCTCAGGGTACAGCTC
Optic |L04R04| L|a_1CCAACTCCGCGATCTCAGGGTACA
OWB R |L04R04| R|a_1..........AGGTGAGGGCTGCCGCTT
OWB R |L03R04| L|a_1CCATCtCCGcTgGcGcAgg
OWB R |L04R04| L|a_1TAGTTCTTGCAGGTGAGGGCTGCC
OWB R |L03R04| R|a_1.........cTgGCgCAGGCTGCCGCTT
Steptoe |L03R04| R|a_1.........ctgg*tcAgGCTGCCGTTT
Steptoe |L04R04| L|a_1TAGTTCTTGCAGGTGAGGGCTGCC
Steptoe |L03R04| L|a_1tgcgtcatcatactgcagg
Steptoe |L04R04| R|a_1.........cAGGTGAGGGCTGCCGCTT