Polymorphisms for ABC01834

Schematic of mutation locations within contig assembly 'ABC01834_1'

(Hover mouse over vertical lines to see details of SNP locations. SNPs are in green, INDELS are in red)

View as SVG diagram



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 4
1
7
4
2
0
4
2
6
4
2
7
4
3
1
4
3
2
4
3
3
4
3
6
4
3
7
4
4
0
4
4
3
4
4
4
4
4
6
4
4
9
4
5
0
4
5
2
4
5
3
4
5
4
4
5
5
4
5
6
4
5
7
4
5
8
4
6
0
4
6
1
4
6
3
4
6
4
4
6
6
4
6
7
4
7
5
4
7
9
4
8
0
4
8
1
4
8
2
4
8
5
4
9
0
4
9
9
5
1
0
5
2
2
5
3
5
6
7
1
7
1
2
Golden Promise |L01R01| R|a_1tgatttgccctttttttccctcttgtctttgtgcaactgcc
Golden Promise |L01R01| L|a_1gttttcccctggaccaggaggaccctcgaaaagcgctatAT
Morex |L01R01| R|a_1AACCCGTCTATAGTTTTAGAGGTTACAACCGGAAATCTTCT
Morex |L01R01| L|a_1AACCCGTCTATAGTTTTAGAGGTTACAACCGGAAATCTTCg
OWB D |L01R01| R|a_1ACGTGACTCGGTCCCCCGTTCCACGTCCTGTCTTGCTTCAC
OWB D |L01R01| L|a_1ACGTGACTCGGTCCCCCGTTCCACGTCCTGTCTTGCTTCAC
Optic |L01R01| R|a_1AACCCGTCTATAGTTTTAGAGGTTATAATGTGAAGCCCTTg
Optic |L01R01| L|a_1tggggacgtccttgacatgactcgccctaagtccgtcac*T
OWB R |L01R01| R|a_1AACCCGTCTATAGTTTTAGAGGTTATAATGTGAAGCCCTTA
OWB R |L01R01| L|a_1AACCCGTCTATAGTTTTAGAGGTTATAATGTGAAGCCCTTA
Steptoe |L01R01| R|a_1nnCCCGTcnAtcgctctacagggtATAATGTGAaGCCCcgg