Polymorphisms for ABC04135

Schematic of mutation locations within contig assembly 'ABC04135_1'

(Hover mouse over vertical lines to see details of SNP locations. SNPs are in green, INDELS are in red)

View as SVG diagram



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 5
5
6
7
2
0
2
2
3
5
2
5
0
3
3
1
3
9
7
4
2
4
4
4
5
4
4
6
4
6
3
4
6
6
4
6
7
5
2
7
5
4
0
6
0
0
6
0
1
6
0
2
6
0
4
6
2
8
6
5
1
6
5
7
6
6
7
6
7
4
6
7
5
6
7
9
Golden Promise |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
Golden Promise |L01R01| L|a_1CGGTACTCCAA**GCTTTGCTGTCAG
HS92 |L01R01| L|a_1TCGCTTCGCGACGACGTCTGGTCTGG
Lina |L01R01| R|a_1CGACTCTCC****GCGCTGCGGTTGT
Lina |L01R01| L|a_1CGACTCTCC****GCGCTGCGGT*gT
Morex |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
Morex |L01R01| L|a_1CGGTACTCCAA**GCTTTGCTGTCAG
OWB D |L01R01| L|a_1TCGCTCTCCGAATGTGCTGCGGTTGT
OWB D |L01R01| R|a_1TCGCTCTCCGAATGTGCTGCGGTTGT
Optic |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
OWB R |L01R01| L|a_1TCGCTTCGCGACGACGTCTGGTCTGG
OWB R |L01R01| R|a_1TCGCTTCGCGACGACGTCTGGTCTGG
Steptoe |L01R01| R|a_1CGGTACTCCAA**GCTTTGCTGTCAG
Steptoe |L01R01| L|a_1CGGTACTCCAA**GCTTTGCTGTCAG