Polymorphisms for ABC07501

Schematic of mutation locations within contig assembly 'ABC07501_1'

(Hover mouse over vertical lines to see details of SNP locations. SNPs are in green, INDELS are in red)

View as SVG diagram



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 9
1
1
6
8
1
8
4
2
6
5
2
6
8
2
7
6
3
1
6
3
2
5
3
2
7
3
3
2
3
3
4
3
3
9
3
4
1
3
5
6
3
5
9
3
7
2
4
1
5
4
1
8
4
4
5
4
6
3
4
6
6
4
8
4
5
3
6
5
5
3
5
8
3
5
9
3
6
0
2
6
1
5
6
1
9
6
2
7
6
3
4
6
3
5
Golden Promise |L01R01| R|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
Golden Promise |L01R01| L|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
HS92 |L01R01| L|a_1CACCGCCTATACTCGTCTTCGATCCCCA*ATG
HS92 |L01R01| R|a_1CACCGCCTATACTCGTCTTCGATCCCCA*ATG
Lina |L01R01| R|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
Lina |L01R01| L|a_1CACCGCCTATACTCGTTATCGATCTCCA*ATG
Morex |L01R01| L|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
Morex |L01R01| R|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
OWB D |L01R01| L|a_1TGCCACCGATACTCGTCTTCTATTCCCAGATG
OWB D |L01R01| R|a_1TGCCACCGATACTCGTCTTCTATTCCCAGATG
Optic |L01R01| L|a_1CACCGCCTATACGCGTCTTCGATCCCCA*ATG
Optic |L01R01| R|a_1CACCGCCTATACGCGTCTTCGATCCCCA*ATG
OWB R |L01R01| R|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
OWB R |L01R01| L|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
Steptoe |L01R01| R|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA
Steptoe |L01R01| L|a_1TGTGGTTTTCCC*TAGCTCTGGCCCGGAAGCA