Polymorphisms for ABC17320

Schematic of mutation locations within contig assembly 'ABC17320_1'

(Hover mouse over vertical lines to see details of SNP locations. SNPs are in green, INDELS are in red)

View as SVG diagram



Polymorphic base positions


Positions indicated by red arrows are mapped SNPs.
SNPs detected by primers
Consensus sequence positions 5
0
5
9
6
1
7
1
8
2
8
3
1
1
1
1
1
9
1
3
2
1
4
5
1
4
6
1
7
5
1
7
6
3
1
2
4
5
3
4
6
5
4
6
8
4
8
0
4
8
3
5
1
4
Golden Promise |L01R01| L|a_1AGTGAAGCGCATTGCGGGTT
Golden Promise |L01R01| R|a_1AGTGAAGCGCATTGCGGGTT
HS92 |L01R01| L|a_1AGCCAAAAGCATTTTGGGTC
HS92 |L01R01| R|a_1AGCCAAAAGCATTTTGGGTC
Lina |L01R01| R|a_1AGTGAAGCGCATTGCGGGTT
Lina |L01R01| L|a_1AGTGAAgCGCATTGCGGGTT
Morex |L01R01| L|a_1ACCGTTGCCATT*GCAATCT
Morex |L01R01| R|a_1TttTATAGGGAATAC*gGCT
OWB D |L01R01| L|a_1AGCGAAGCCCTT*GCAATCT
OWB D |L01R01| R|a_1CTACTTATAGAATGAAATAG
Optic |L01R01| R|a_1ATAACGTAGGTCACCGCTGC
Optic |L01R01| L|a_1AGCGTAGCCATT*GCGGGTT
OWB R |L01R01| L|a_1GGCGTAGCGCATTGCGGGTT
OWB R |L01R01| R|a_1GGCGTAGCGCATTGCGGGTt
Steptoe |L01R01| R|a_1AGtGAAGCGCATTGCGGGTg
Steptoe |L01R01| L|a_1AGTGAAGCGCATTGCGGGTT